Summary for the 315-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 315 S |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7u | E (beta-strand) | e (exposed) | 37.5 |
Predicted Bind Molecules |
homo:4 nucleotide:2 |
Templates for 3D complexes |
homo [75952:R1AB_CVHSA ] 2ozk_A_1_C_1 2ozk_B_1_D_1 2ozk_C_1_B_1 2ozk_D_1_A_1 nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_A_1_H_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_A_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |