#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 126-th Site(R)

PID QueryLength FocusSite TITLE
31190 346 126 R
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:68% S:32% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r T (Hbond turn) e (exposed) 20.6
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:3 precipitant:6
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_C_1_H_1 compound [VWG ] 5sac_B_4_E_4 5sac_B_5_E_5 5sac_B_6_E_6 precipitant [GOL ] 6vww_A_1_D_1 6vww_A_2_D_2 6vww_A_3_D_3 [FMT ] 6xdh_B_1_I_1 6xdh_B_3_I_3 6xdh_B_5_I_5


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]