#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 18-th Site(Q)

PID QueryLength FocusSite TITLE
9866 346 18 Q
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:37% R:16% Q:12% I:11% L:7% A:6% H:6% D:5% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r (coil) e (exposed) 37.2
3D Complex Information
Predicted Bind Molecules
nucleotide:5
Templates for 3D complexes
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_C_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_C_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_D_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]