#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 58-th Site(M)
PID QueryLength FocusSite TITLE
4636 527 58 M
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
M:91% L:9%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq (coil) e (exposed) 27.5
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:6
Templates for 3D complexes
nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 compound [UX1 ] 5slu_A_1_G_1 [EJQ ] 5slv_A_1_G_1 [LMW ] 5slx_A_1_G_1 [LQP ] 5slz_A_1_G_1 [I8D ] 5sme_A_1_G_1 [LQV ] 5smi_A_1_G_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]