Summary for the 79-th Site(H)

PID QueryLength FocusSite TITLE
20585 425 79 H RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3;
UniProt Information
AC/IDAC:P84022 ID:SMAD3_HUMAN
Feature Table for 79-th site VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793"
DOMAIN: /note="MH1"
VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348"
CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
H:35% G:33% F:14% S:10% A:7% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
1ozj T (Hbond turn) e (exposed) 91.6
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:15 precipitant:2
Templates for 3D complexes
homo [31745:SMAD3_HUMAN ] 1ozj_C_1_D_1 1ozj_D_1_C_1 [31440:SMAD5_MOUSE ] 5x6h_A_1_A_2 5x6h_A_2_A_1 nucleotide [atgcgggcgcgcccgcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mey_A_1_B_1 5mey_A_2_B_2 5nm9_B_1_D_3 5nm9_B_2_D_1 [acgggccgcggcccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mf0_B_2_D_1 [tgcaggcgcgcctgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5od6_A_1_D_1 6fzt_A_1_C_1 6fzt_B_2_D_2 6tbz_A_1_B_1 6zmn_A_1_D_2 6zmn_B_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_1 5x6h_A_2_B_2 [atcagactgccggcagtctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_D_1_B_1 5x6m_H_1_F_1 precipitant [GOL ] 3kmp_A_1_F_1 3kmp_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]