Summary for the 33-rd Site(V) |
PID | QueryLength | FocusSite | TITLE |
6678 | 198 | 33 V |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:81% V:11% S:8% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 75.3 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_B_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_B_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |