#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 92-nd Site(E)

PID QueryLength FocusSite TITLE
5815 527 92 E
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq E (beta-strand) b (buried) 15.6
3D Complex Information
Predicted Bind Molecules
nucleotide:6 compound:2 metal:9 precipitant:1
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 compound [O2M ] 5sky_A_1_G_1 [WKS ] 5smd_A_1_G_1 metal [MG ] 7egq_H_1_GA_1 7egq_P_1_SA_1 7mc6_A_1_M_1 7n0c_B_1_G_1 7n0d_B_1_Q_1 7n0d_D_1_X_1 7n0d_I_1_EA_1 7n0d_K_1_MA_1 [CA ] 7n0b_B_1_G_1 precipitant [EDO ] 7mc5_A_1_N_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]