Summary for the 72-nd Site(D) |
PID | QueryLength | FocusSite | TITLE |
22598 | 425 | 72 D | RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3; |
AC/ID | AC:P84022 ID:SMAD3_HUMAN |
Feature Table for 72-th site |
STRAND: VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793" DOMAIN: /note="MH1" VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348" CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:69% N:15% L:2% A:1% R:1% Q:1% E:1% G:1% I:1% K:1% F:1% P:1% S:1% T:1% Y:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
1ozj | T (Hbond turn) | e (exposed) | 54.9 |
Predicted Bind Molecules |
nucleotide:5 |
Templates for 3D complexes |
nucleotide [acgggccgcggcccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mf0_A_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_1 5x6h_A_2_B_2 [ttatagactgccggcagtctgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_A_1_C_1 5x6m_E_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |