Summary for the 97-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
19863 | 527 | 97 T |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:38% C:31% S:18% I:7% V:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 28.6 |
Predicted Bind Molecules |
hetero:3 nucleotide:1 compound:1 precipitant:1 |
Templates for 3D complexes |
hetero [99138:R1AB_SARS2 ] 7egq_H_1_A_1 7egq_P_1_I_1 7eiz_I_1_A_1 nucleotide [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 compound [LJA ] 5slf_A_1_H_1 precipitant [TLA ] 7mc5_A_1_P_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |