Summary for the 190-th Site(F) |
PID | QueryLength | FocusSite | TITLE |
19863 | 527 | 190 F |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
F:39% N:34% L:27% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | H (alpha-helix) | b (buried) | 18.7 |
Predicted Bind Molecules |
nucleotide:2 compound:2 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 compound [UX1 ] 5slu_A_1_H_1 [K1S ] 5smf_A_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |