#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 190-th Site(F)

PID QueryLength FocusSite TITLE
19863 527 190 F
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
F:39% N:34% L:27% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq H (alpha-helix) b (buried) 18.7
3D Complex Information
Predicted Bind Molecules
nucleotide:2 compound:2
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 compound [UX1 ] 5slu_A_1_H_1 [K1S ] 5smf_A_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]