Summary for the 187-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
19863 | 527 | 187 A |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:52% S:29% G:14% C:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | S (bend) | e (exposed) | 40.2 |
Predicted Bind Molecules |
nucleotide:5 metal:6 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 metal [MG ] 5c8s_B_1_J_1 5c8t_B_1_J_1 5c8t_D_1_Q_1 5c8u_B_1_J_1 5c8u_D_1_P_1 [CA ] 7n0b_B_1_H_1 precipitant [EDO ] 7mc6_A_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |