#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 104-th Site(N)

PID QueryLength FocusSite TITLE
19863 527 104 N
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq E (beta-strand) e (exposed) 26.1
3D Complex Information
Predicted Bind Molecules
hetero:3 nucleotide:10 compound:2 precipitant:1
Templates for 3D complexes
hetero [30666:Q1T6X8_CVHSA ] 5nfy_C_1_H_1 5nfy_D_1_G_1 [27995:R1AB_SARS2 ] 7egq_H_1_F_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 compound [LJA ] 5slf_A_1_H_1 [K1S ] 5smf_A_1_G_1 precipitant [EDO ] 7mc5_A_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]