Summary for the 930-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 930 V |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:58% T:34% I:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 64.7 |
Predicted Bind Molecules |
nucleotide:5 |
Templates for 3D complexes |
nucleotide [ugacugcucccuagcaugcuacuaccg ] 8gwe_A_1_J_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwf_A_1_F_1 8gwg_A_1_F_1 8gwi_A_1_F_1 [agcugcucccuagcaugcuacuaccg ] 8gwk_A_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |