Summary for the 553-rd Site(R) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 553 R |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:70% K:30% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | S (bend) | e (exposed) | 47.4 |
Predicted Bind Molecules |
nucleotide:3 compound:6 precipitant:3 |
Templates for 3D complexes |
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [GE6 ] 7ctt_A_1_J_1 [H3U ] 7d4f_D_1_H_1 [AT9 ] 7ed5_A_1_K_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 precipitant [POP ] 7bv2_A_1_H_1 7dfg_C_1_J_1 7doi_A_1_I_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |