Summary for the 95-th Site(H) |
PID | QueryLength | FocusSite | TITLE |
5815 | 527 | 95 H |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | E (beta-strand) | e (exposed) | 39.3 |
Predicted Bind Molecules |
hetero:3 nucleotide:2 |
Templates for 3D complexes |
hetero [28097:R1AB_SARS2 ] 7egq_H_1_F_1 7egq_P_1_N_1 7eiz_I_1_E_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |