|
PID | QueryLength | FocusSite | TITLE |
5815 | 527 | 58 M |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
M:91% L:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 27.5 |
Predicted Bind Molecules |
nucleotide:6 compound:6 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |