#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 482-nd Site(H)

PID QueryLength FocusSite TITLE
5541 601 482 H
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
H:29% I:18% V:12% C:11% L:11% Q:10% S:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez (coil) e (exposed) 46.6
3D Complex Information
Predicted Bind Molecules
homo:2 nucleotide:3 compound:1
Templates for 3D complexes
homo [94973:R1AB_SARS2 ] 7nio_A_1_B_1 7nio_B_1_A_1 nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [K2P ] 5rlh_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]