Summary for the 408-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 408 P |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:64% K:13% E:10% A:1% R:1% N:1% D:1% Q:1% G:1% I:1% L:1% F:1% S:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | (coil) | e (exposed) | 61.2 |
Predicted Bind Molecules |
nucleotide:5 compound:1 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VXD ] 5rml_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |