Summary for the 337-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 337 R |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:23% K:21% N:16% Y:14% E:13% I:13% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | (coil) | e (exposed) | 58.1 |
Predicted Bind Molecules |
nucleotide:2 compound:1 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 compound [NYV ] 5rlk_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |