Summary for the 79-th Site(I) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 79 I |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:46% I:20% Y:20% C:13% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | S (bend) | e (exposed) | 74.9 |
Predicted Bind Molecules |
hetero:24 nucleotide:1 |
Templates for 3D complexes |
hetero [28567:R1AB_SARS2 ] 6xez_F_1_B_1 7cxm_H_1_B_1 7cxn_H_1_B_1 7cyq_G_1_D_1 7eiz_J_1_B_1 7eiz_K_1_D_1 7kro_F_1_B_1 8gw1_G_1_D_1 8gw1_H_1_B_1 8gwb_E_1_D_1 8gwb_F_1_B_1 8gwe_E_1_B_1 8gwe_F_1_D_1 8gwf_G_1_D_1 8gwf_H_1_B_1 8gwg_G_1_D_1 8gwg_H_1_B_1 8gwi_G_1_D_1 8gwi_H_1_B_1 8gwk_H_1_B_1 8gwn_G_1_D_1 8gwn_H_1_B_1 8gwo_G_1_D_1 8gwo_H_1_B_1 nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |