Summary for the 382-nd Site(Y) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 382 Y |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Y:41% L:15% I:12% H:10% P:9% N:8% A:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | H (alpha-helix) | b (buried) | 11.7 |
Predicted Bind Molecules |
nucleotide:1 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 compound [6SU ] 5rmc_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |