Summary for the 335-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
5541 | 601 | 335 P |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:70% A:16% K:13% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 71.3 |
Predicted Bind Molecules |
nucleotide:3 compound:2 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VVG ] 5rl8_A_1_C_1 [NYV ] 5rlk_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |