Summary for the 848-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
5303 | 932 | 848 V |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:41% S:30% L:18% D:6% T:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | G (3/10-helix) | e (exposed) | 52.7 |
Predicted Bind Molecules |
hetero:30 nucleotide:5 |
Templates for 3D complexes |
hetero [28567:R1AB_SARS2 ] 6yyt_A_1_D_1 7c2k_A_1_D_1 7dok_C_1_F_1 7dte_A_1_D_1 7ed5_A_1_D_1 7egq_A_1_D_1 7egq_I_1_L_1 7krn_A_1_D_1 7kro_A_1_D_1 7krp_A_1_D_1 7rdx_A_1_D_1 7rdy_A_1_D_1 7rdz_A_1_D_1 7re0_A_1_D_1 7re1_A_1_D_1 7re2_A_1_D_1 7re3_A_1_D_1 7re3_J_1_L_1 7uo4_A_1_D_1 7uo7_A_1_F_1 7uo9_A_1_F_1 7uob_A_1_D_1 7uoe_A_1_D_1 8gwb_A_1_D_1 8gwe_A_1_D_1 8gwk_A_1_D_1 8gwn_A_1_D_1 8sq9_A_1_D_1 8sqj_A_1_D_1 8sqk_A_1_D_1 nucleotide [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [gcgguaguagcaugcuagggagcag ] 7eiz_A_1_G_1 8gw1_A_1_E_1 8gwm_A_1_H_1 8gwo_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |