#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 513-rd Site(R)

PID QueryLength FocusSite TITLE
5303 932 513 R
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:33% D:16% K:13% T:13% G:10% S:4% L:2% A:1% N:1% Q:1% E:1% I:1% F:1% P:1% Y:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 45.8
3D Complex Information
Predicted Bind Molecules
nucleotide:32
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdx_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re0_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 7doi_A_1_D_1 [gcuaugug ] 7dfh_A_1_E_1 [gcuaugugagauuaaguuau ] 7dok_C_1_A_1 7ed5_A_1_E_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_A_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagug ] 7ozv_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_A_1_E_1 [gcgguaguagcaugcuagggagcag ] 8gw1_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]