Summary for the 497-th Site(N) |
PID | QueryLength | FocusSite | TITLE |
5303 | 932 | 497 N |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:43% P:17% A:16% K:12% S:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | (coil) | e (exposed) | 60.6 |
Predicted Bind Molecules |
nucleotide:2 compound:1 |
Templates for 3D complexes |
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [aagaagcuauuaaaaucaca ] 8g6r_A_1_D_1 compound [H3U ] 7d4f_D_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |