Summary for the 555-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
5303 | 932 | 555 R |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | (coil) | e (exposed) | 26.1 |
Predicted Bind Molecules |
nucleotide:6 compound:10 |
Templates for 3D complexes |
nucleotide [xxxxxxugcaucgcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3b_A_1_E_1 [xxxxxxxxxxxxxxxxxcugugucgucxxxx ] 7bzf_A_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 compound [F86 ] 7bv2_A_1_K_1 [GE6 ] 7ctt_A_1_J_1 [H3U ] 7d4f_D_1_H_1 [RVP ] 7dfh_A_1_N_1 [NWX ] 7uo4_A_1_G_1 [ATP ] 7uo7_A_1_G_1 [UTP ] 7uo9_A_1_J_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |