Summary for the 544-th Site(L) |
PID | QueryLength | FocusSite | TITLE |
5303 | 932 | 544 L |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:73% T:15% K:12% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | E (beta-strand) | b (buried) | 16.9 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |