Summary for the 62-nd Site(M) |
PID | QueryLength | FocusSite | TITLE |
4194 | 198 | 62 M |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 55.1 |
Predicted Bind Molecules |
hetero:35 nucleotide:3 |
Templates for 3D complexes |
hetero [17046:R1AB_CVHSA ] 2ahm_G_1_D_1 2ahm_G_2_D_2 2ahm_H_1_C_1 2ahm_H_2_C_2 [21583:R1AB_FIPV ] 3ub0_A_1_B_1 3ub0_D_1_E_1 [94384:R1AB_SARS2 ] 6xez_B_1_F_1 6xez_D_1_E_1 7cxm_B_1_H_1 7cxn_B_1_H_1 7cyq_B_1_H_1 7cyq_D_1_G_1 7eiz_B_1_J_1 7eiz_D_1_K_1 7krn_D_1_E_1 7kro_B_1_F_1 8gw1_B_1_H_1 8gw1_D_1_G_1 8gwb_B_1_F_1 8gwb_D_1_E_1 8gwe_B_1_E_1 8gwe_D_1_F_1 8gwf_B_1_H_1 8gwf_D_1_G_1 8gwg_B_1_H_1 8gwg_D_1_G_1 8gwi_B_1_H_1 8gwi_D_1_G_1 8gwk_B_1_H_1 8gwm_B_1_F_1 8gwm_D_1_E_1 8gwn_B_1_H_1 8gwn_D_1_G_1 8gwo_B_1_H_1 8gwo_D_1_G_1 nucleotide [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_D_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_D_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |