#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 46-th Site(K)

PID QueryLength FocusSite TITLE
4194 198 46 K
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 65.1
3D Complex Information
Predicted Bind Molecules
nucleotide:8
Templates for 3D complexes
nucleotide [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_B_1_E_1 [gcuaugugagauuaaguuau ] 7ed5_B_1_E_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_B_1_F_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7kro_D_1_H_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krp_D_1_F_1 [xxxxxxxxxxxxxxxxgugaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uoe_D_1_F_1 [agcugcucccuagcaugcuacuaccg ] 8gw1_B_1_F_1 [gcgguaguagcaugcuagggagcag ] 8gwk_B_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]