#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 44-th Site(V)

PID QueryLength FocusSite TITLE
4194 198 44 V
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
I:59% V:41% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 64.7
3D Complex Information
Predicted Bind Molecules
hetero:4 homo:4 nucleotide:9
Templates for 3D complexes
hetero [17046:R1AB_CVHSA ] 2ahm_G_1_A_2 2ahm_G_2_A_1 2ahm_H_1_B_2 2ahm_H_2_B_1 homo [28567:R1AB_CVHSA ] 2ahm_G_1_E_2 2ahm_G_2_E_1 2ahm_H_1_F_2 2ahm_H_2_F_1 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_D_1_F_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_D_1_F_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_B_1_G_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krp_B_1_F_1 [xxxxxxxxxxxxxxxxgugaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uoe_B_1_F_1 7uoe_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_B_1_J_1 8gwb_D_1_J_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 8sq9_B_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]