#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 58-th Site(K)

PID QueryLength FocusSite TITLE
4194 198 58 K
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 60.8
3D Complex Information
Predicted Bind Molecules
hetero:15 homo:4 nucleotide:8
Templates for 3D complexes
hetero [94384:R1AB_SARS2 ] 7cxm_B_1_H_1 7cxn_B_1_H_1 7cyq_D_1_G_1 7eiz_B_1_J_1 7eiz_D_1_K_1 7kro_B_1_F_1 8gw1_B_1_H_1 8gw1_D_1_G_1 8gwe_D_1_F_1 8gwf_D_1_G_1 8gwg_D_1_G_1 8gwi_D_1_G_1 8gwk_B_1_H_1 8gwn_D_1_G_1 8gwo_D_1_G_1 homo [28567:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_D_1_F_1 [gcuaugugagauuaaguuau ] 7ed5_D_1_E_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_D_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacxxx ] 7uo7_B_1_E_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uob_D_1_F_1 [agcugcucccuagcaugcuacuaccg ] 8gw1_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_B_1_J_1 [gcgguaguagcaugcuagggagcag ] 8gwk_D_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]