#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 36-th Site(K)

PID QueryLength FocusSite TITLE
4194 198 36 K
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:78% A:14% N:8% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 30.2
3D Complex Information
Predicted Bind Molecules
nucleotide:10
Templates for 3D complexes
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_B_1_F_1 7krn_D_1_F_1 7kro_D_1_G_1 7krp_D_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_B_1_E_1 7uo4_D_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_B_1_D_1 7uo7_F_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_F_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_D_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]