#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 42-nd Site(L)

PID QueryLength FocusSite TITLE
4194 198 42 L
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
M:31% C:22% V:16% A:14% L:11% F:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) b (buried) 17.4
3D Complex Information
Predicted Bind Molecules
homo:2 nucleotide:1
Templates for 3D complexes
homo [28576:R1AB_CVHSA ] 2ahm_E_1_H_1 2ahm_E_2_H_2 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cxn_B_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]