Summary for the 57-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
4194 | 198 | 57 R |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:62% K:38% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 62.1 |
Predicted Bind Molecules |
homo:4 nucleotide:13 |
Templates for 3D complexes |
homo [28567:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_D_1_G_1 [gcgguaguagcaugcuagggagcag ] 7cxm_D_1_E_1 7cxn_D_1_E_1 8gwe_B_1_I_1 8gwf_B_1_E_1 8gwg_B_1_E_1 8gwi_B_1_E_1 8gwk_B_1_E_1 8gwn_B_1_E_1 [gcuaugugagauuaaguuau ] 7ed5_D_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_D_1_F_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_F_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uob_D_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |