Summary for the 69-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
4093023 | 740 | 69 K | RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB; |
AC/ID | AC:Q92499 ID:DDX1_HUMAN |
Feature Table for 69-th site |
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453" REGION: /note="Necessary for interaction with HNRNPK" DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with dsRNA" REGION: /note="Necessary for interaction with RELA" CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:44% R:10% P:7% N:6% A:5% L:5% S:4% E:3% G:3% Q:2% Y:2% D:1% H:1% I:1% M:1% F:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8tbx | T (Hbond turn) | e (exposed) | 32.5 |
Predicted Bind Molecules |
hetero:1 nucleotide:6 |
Templates for 3D complexes |
hetero [63117:E9Q238_MOUSE ] 7ddx_B_1_A_1 nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_A_1_B_1 7pli_C_1_D_1 7pli_G_1_H_1 7pli_I_1_J_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_C_1_G_1 7pmq_D_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |