#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 136-th Site(N)

PID QueryLength FocusSite TITLE
3796307 346 136 N
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:17% K:15% L:12% A:11% N:10% T:10% Q:9% R:6% M:5% V:5% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r H (alpha-helix) e (exposed) 78.2
3D Complex Information
Predicted Bind Molecules
nucleotide:6
Templates for 3D complexes
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_E_1_H_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_E_1_H_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]