#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 315-th Site(S)

PID QueryLength FocusSite TITLE
3796307 346 315 S
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r E (beta-strand) e (exposed) 35.9
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:5
Templates for 3D complexes
homo [76283:R1AB_CVHSA ] 2ozk_A_1_C_1 2ozk_B_1_D_1 2ozk_C_1_B_1 2ozk_D_1_A_1 nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_A_1_H_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_A_1_H_1 [xxxxxxxxxxxxxxxaaaaaaaaaaaaaaaaaxxx ] 8ud3_E_1_H_1 [xxxxxxxxxxxxgacaaaaaaaaaaaaaaaaaaaa ] 8ud4_E_1_H_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_E_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]