Summary for the 147-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 147 S |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:47% A:26% C:11% S:10% V:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | (coil) | e (exposed) | 86.7 |
Predicted Bind Molecules |
nucleotide:5 compound:3 precipitant:24 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_C_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_C_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_D_1_G_1 compound [VWG ] 5sac_B_4_E_4 5sac_B_5_E_5 5sac_B_6_E_6 precipitant [EDO ] 6w01_B_1_CA_1 6w01_B_2_CA_2 6w01_B_3_CA_3 6w01_B_1_U_1 6w01_B_2_U_2 6w01_B_3_U_3 6w01_B_1_Y_1 6w01_B_2_Y_2 6w01_B_3_Y_3 6wxc_B_1_O_1 6wxc_B_2_O_2 6wxc_B_3_O_3 6x4i_B_1_T_1 6x4i_B_2_T_2 6x4i_B_3_T_3 [ACT ] 6wlc_B_1_T_1 6wlc_B_2_T_2 6wlc_B_3_T_3 [FMT ] 6wxc_B_1_Q_1 6wxc_B_2_Q_2 6wxc_B_3_Q_3 6wxc_B_1_R_1 6wxc_B_2_R_2 6wxc_B_3_R_3 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |