Summary for the 146-th Site(G) |
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 146 G |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:27% R:17% G:15% Q:11% N:10% S:9% V:6% E:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7u | S (bend) | e (exposed) | 46.4 |
Predicted Bind Molecules |
nucleotide:5 compound:3 precipitant:18 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_C_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_C_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_D_1_G_1 compound [VWG ] 5sac_B_4_E_4 5sac_B_5_E_5 5sac_B_6_E_6 precipitant [GOL ] 6vww_A_1_D_1 6vww_A_2_D_2 6vww_A_3_D_3 [EDO ] 6w01_B_1_CA_1 6w01_B_2_CA_2 6w01_B_3_CA_3 6x4i_B_1_T_1 6x4i_B_2_T_2 6x4i_B_3_T_3 [ACT ] 6wlc_B_1_T_1 6wlc_B_2_T_2 6wlc_B_3_T_3 [FMT ] 6wxc_B_1_Q_1 6wxc_B_2_Q_2 6wxc_B_3_Q_3 6xdh_B_1_I_1 6xdh_B_3_I_3 6xdh_B_5_I_5 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |