Summary for the 18-th Site(Q) |
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 18 Q |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:37% R:16% Q:12% I:11% L:7% A:6% H:6% D:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | (coil) | e (exposed) | 37.2 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_C_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_D_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_D_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |