|
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 314 V |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
V:63% Q:11% K:10% I:8% A:1% R:1% D:1% E:1% G:1% L:1% P:1% S:1% T:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 65.3 |
Predicted Bind Molecules |
nucleotide:3 precipitant:21 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |