|
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 136 N |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:17% K:15% L:12% A:11% N:10% T:10% Q:9% R:6% M:5% V:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 84.8 |
Predicted Bind Molecules |
nucleotide:6 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |