|
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 128 D |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:28% Q:13% A:11% L:10% D:6% E:6% K:6% T:6% V:6% P:5% R:1% G:1% I:1% S:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 101.9 |
Predicted Bind Molecules |
nucleotide:3 precipitant:6 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |