#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 112-nd Site(T)

PID QueryLength FocusSite TITLE
3796307 346 112 T
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:15% N:14% T:14% I:13% D:11% L:4% E:3% G:3% K:3% S:3% V:3% R:2% Q:2% F:2% P:2% C:1% H:1% M:1% W:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
5sbf T (Hbond turn) e (exposed) 59.1
3D Complex Information
Predicted Bind Molecules
homo:3 nucleotide:3 precipitant:3
Templates for 3D complexes
homo [77638:A0A0U2GPI9_9BETC ] 5yvd_B_4_A_3 5yvd_B_5_A_1 5yvd_B_6_A_2 nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 precipitant [EDO ] 6x1b_B_1_G_1 6x1b_B_2_G_2 6x1b_B_3_G_3


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]