Summary for the 110-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
3796307 | 346 | 110 K |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:30% K:19% L:12% E:9% Q:7% A:3% R:2% D:2% G:2% I:2% P:2% S:2% T:2% V:2% C:1% H:1% M:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
5sbf | S (bend) | e (exposed) | 64.6 |
Predicted Bind Molecules |
homo:3 nucleotide:3 |
Templates for 3D complexes |
homo [77638:A0A0U2GPI9_9BETC ] 5yvd_A_1_B_5 5yvd_A_2_B_6 5yvd_A_3_B_4 nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |