#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 132-nd Site(D)

PID QueryLength FocusSite TITLE
3796307 346 132 D
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:70% Q:11% D:10% S:9% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u H (alpha-helix) e (exposed) 60.5
3D Complex Information
Predicted Bind Molecules
nucleotide:4 precipitant:6
Templates for 3D complexes
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_B_1_H_1 precipitant [SO4 ] 2gti_A_1_D_1 2gti_A_2_D_2 2gti_A_3_D_3 2gti_A_4_D_4 2gti_A_5_D_5 2gti_A_6_D_6


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]