#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 293-rd Site(S)

PID QueryLength FocusSite TITLE
31190 346 293 S
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
T:67% S:33% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r E (beta-strand) b (buried) 0.0
3D Complex Information
Predicted Bind Molecules
nucleotide:10 compound:24 precipitant:21
Templates for 3D complexes
nucleotide [gu ] 6x1b_A_1_C_1 6x1b_A_2_C_2 6x1b_A_3_C_3 6x1b_B_1_D_1 6x1b_B_2_D_2 6x1b_B_3_D_3 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 compound [U5P ] 6wlc_A_1_C_1 6wlc_A_2_C_2 6wlc_A_3_C_3 6wlc_B_1_M_1 6wlc_B_2_M_2 6wlc_B_3_M_3 7k0r_A_1_G_1 7k0r_B_1_I_1 7k0r_C_1_K_1 7k0r_D_1_M_1 7k0r_E_1_O_1 7k0r_F_1_Q_1 [CMU ] 6wxc_A_1_C_1 6wxc_A_2_C_2 6wxc_A_3_C_3 6wxc_B_1_M_1 6wxc_B_2_M_2 6wxc_B_3_M_3 [UVC ] 7k1l_A_1_C_1 7k1l_A_2_C_2 7k1l_A_3_C_3 7k1l_B_1_H_1 7k1l_B_2_H_2 7k1l_B_3_H_3 precipitant [PEG ] 6w01_A_1_G_1 6w01_A_2_G_2 6w01_A_3_G_3 [EDO ] 6x4i_A_1_D_1 6x4i_A_2_D_2 6x4i_A_3_D_3 6x4i_A_1_I_1 6x4i_A_2_I_2 6x4i_A_3_I_3 6x4i_B_1_R_1 6x4i_B_2_R_2 6x4i_B_3_R_3 6x4i_B_1_S_1 6x4i_B_2_S_2 6x4i_B_3_S_3 7k1o_A_1_E_1 7k1o_A_2_E_2 7k1o_B_1_G_1 7k1o_B_2_G_2 7k1o_C_1_I_1 7k1o_C_2_I_2


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]