#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 339-th Site(E)
PID QueryLength FocusSite TITLE
31190 346 339 E
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
Q:38% K:21% M:17% S:11% E:8% A:4%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r E (beta-strand) e (exposed) 43.7
3D Complex Information
Predicted Bind Molecules
nucleotide:4 compound:12 precipitant:3
Templates for 3D complexes
nucleotide [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 compound [U3P ] 6x4i_A_1_C_1 6x4i_A_2_C_2 6x4i_A_3_C_3 6x4i_B_1_O_1 6x4i_B_2_O_2 6x4i_B_3_O_3 [VQV ] 7k1o_A_1_D_1 7k1o_A_2_D_2 7k1o_B_1_F_1 7k1o_B_2_F_2 7k1o_C_1_H_1 7k1o_C_2_H_2 precipitant [ACT ] 6wlc_A_1_F_1 6wlc_A_2_F_2 6wlc_A_3_F_3


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]