Summary for the 339-th Site(E) |
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 339 E |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:38% K:21% M:17% S:11% E:8% A:4% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | E (beta-strand) | e (exposed) | 43.7 |
Predicted Bind Molecules |
nucleotide:4 compound:12 precipitant:3 |
Templates for 3D complexes |
nucleotide [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 compound [U3P ] 6x4i_A_1_C_1 6x4i_A_2_C_2 6x4i_A_3_C_3 6x4i_B_1_O_1 6x4i_B_2_O_2 6x4i_B_3_O_3 [VQV ] 7k1o_A_1_D_1 7k1o_A_2_D_2 7k1o_B_1_F_1 7k1o_B_2_F_2 7k1o_C_1_H_1 7k1o_C_2_H_2 precipitant [ACT ] 6wlc_A_1_F_1 6wlc_A_2_F_2 6wlc_A_3_F_3 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |