#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 247-th Site(G)

PID QueryLength FocusSite TITLE
31190 346 247 G
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
G:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7r (coil) b (buried) 1.2
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:18 precipitant:74
Templates for 3D complexes
nucleotide [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 compound [U3P ] 6x4i_A_1_C_1 6x4i_A_2_C_2 6x4i_A_3_C_3 6x4i_B_1_O_1 6x4i_B_2_O_2 6x4i_B_3_O_3 [UVC ] 7k1l_A_1_C_1 7k1l_A_2_C_2 7k1l_A_3_C_3 7k1l_B_1_H_1 7k1l_B_2_H_2 7k1l_B_3_H_3 [VQV ] 7k1o_A_1_D_1 7k1o_A_2_D_2 7k1o_B_1_F_1 7k1o_B_2_F_2 7k1o_C_1_H_1 7k1o_C_2_H_2 precipitant [PO4 ] 4s1t_A_1_G_1 4s1t_A_2_G_2 4s1t_B_1_H_1 4s1t_B_2_H_2 4s1t_E_1_K_1 4s1t_E_3_K_3 4s1t_F_1_L_1 4s1t_F_2_L_2 6wxc_A_1_D_1 6wxc_A_2_D_2 6wxc_A_3_D_3 6wxc_B_1_N_1 6wxc_B_2_N_2 6wxc_B_3_N_3 6x1b_A_1_E_1 6x1b_A_2_E_2 6x1b_A_3_E_3 6x1b_B_1_I_1 6x1b_B_2_I_2 6x1b_B_3_I_3 7k0r_A_1_H_1 7k0r_B_1_J_1 7k0r_C_1_L_1 7k0r_D_1_N_1 7k0r_E_1_P_1 7k0r_F_1_R_1 7keg_A_1_C_1 7keg_A_2_C_2 7keg_A_3_C_3 7keg_B_4_D_4 7keg_B_5_D_5 7keg_B_6_D_6 [GOL ] 5yvd_A_1_C_1 5yvd_A_2_C_2 5yvd_A_3_C_3 5yvd_B_4_D_4 5yvd_B_5_D_5 5yvd_B_6_D_6 [CIT ] 6w01_A_1_N_1 6w01_A_2_N_2 6w01_A_3_N_3 6w01_B_1_X_1 6w01_B_2_X_2 6w01_B_3_X_3 6xdh_A_1_D_1 6xdh_A_2_D_2 6xdh_A_4_D_4 6xdh_B_1_J_1 6xdh_B_3_J_3 6xdh_B_5_J_5 7k9p_A_1_C_1 7k9p_A_2_C_2 7k9p_A_3_C_3 7k9p_B_4_D_4 7k9p_B_5_D_5 7k9p_B_6_D_6 7kf4_A_1_G_1 7kf4_B_1_H_1 7kf4_C_1_I_1 7kf4_D_1_J_1 7kf4_E_1_K_1 7kf4_F_1_L_1 7n83_A_1_C_1 7n83_A_2_C_2 7n83_A_3_C_3 7n83_B_4_H_4 7n83_B_5_H_5 7n83_B_6_H_6 [SO4 ] 7keh_A_1_D_1 7keh_A_2_D_2 7keh_A_3_D_3 7keh_B_4_F_4 7keh_B_5_F_5 7keh_B_6_F_6


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]